## FastQC v0.11.9
## 2.10
## cutadapt -j 6 -a AGATCGGAAGAG -a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -A AGATCGGAAGAG -A AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT --trim-n -q 30,30 -m 75 -o test_sample_1.trimmed.fq.gz -p test_sample_2.trimmed.fq.gz test_sample_1.fq.gz test_sample_2.fq.gz
| Measure | read1_before | read1_after | read2_before | read2_after |
|---|---|---|---|---|
| Filename | test_sample_1.fq.gz | test_sample_1.trimmed.fq.gz | test_sample_2.fq.gz | test_sample_2.trimmed.fq.gz |
| File type | Conventional base calls | Conventional base calls | Conventional base calls | Conventional base calls |
| Encoding | Sanger / Illumina 1.9 | Sanger / Illumina 1.9 | Sanger / Illumina 1.9 | Sanger / Illumina 1.9 |
| Total Sequences | 1000000 | 987165 | 1000000 | 987165 |
| Sequences flagged as poor quality | 0 | 0 | 0 | 0 |
| Sequence length | 150 | 75-150 | 150 | 75-150 |
| %GC | 46 | 46 | 46 | 46 |
Percent of seqs remaining if deduplicated: 76.31%
No overrepresented sequences
Percent of seqs remaining if deduplicated: 76.81%
No overrepresented sequences
Percent of seqs remaining if deduplicated: 78.88%
No overrepresented sequences
Percent of seqs remaining if deduplicated: 79.47%
No overrepresented sequences