Tools Info

FastQC Version
  ## FastQC v0.11.9
Cutadapt Version
  ## 2.10
Cutadapt Version
 ## cutadapt -j 6 -a AGATCGGAAGAG -a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -A AGATCGGAAGAG -A AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT --trim-n -q 30,30 -m 75 -o test_sample_1.trimmed.fq.gz -p test_sample_2.trimmed.fq.gz test_sample_1.fq.gz test_sample_2.fq.gz

Statistics

Measure read1_before read1_after read2_before read2_after
Filename test_sample_1.fq.gz test_sample_1.trimmed.fq.gz test_sample_2.fq.gz test_sample_2.trimmed.fq.gz
File type Conventional base calls Conventional base calls Conventional base calls Conventional base calls
Encoding Sanger / Illumina 1.9 Sanger / Illumina 1.9 Sanger / Illumina 1.9 Sanger / Illumina 1.9
Total Sequences 1000000 987165 1000000 987165
Sequences flagged as poor quality 0 0 0 0
Sequence length 150 75-150 150 75-150
%GC 46 46 46 46

Read1 Result

Before Trimming

Quality

Nucleotides Dirstribution

Sequence Length Distribution

Sequence Duplication Levels

Percent of seqs remaining if deduplicated: 76.31%

Overrepresented sequences

No overrepresented sequences

Adapter Cotent

After Trimming

Quality

Nucleotides Dirstribution

Sequence Length Distribution

Sequence Duplication Levels

Percent of seqs remaining if deduplicated: 76.81%

Overrepresented sequences

No overrepresented sequences

Adapter Cotent

Read2 Result

Before Trimming

Quality

Nucleotides Dirstribution

Sequence Length Distribution

Sequence Duplication Levels

Percent of seqs remaining if deduplicated: 78.88%

Overrepresented sequences

No overrepresented sequences

Adapter Cotent

After Trimming

Quality

Nucleotides Dirstribution

Sequence Length Distribution

Sequence Duplication Levels

Percent of seqs remaining if deduplicated: 79.47%

Overrepresented sequences

No overrepresented sequences

Adapter Cotent